1nonlyisthebest456 1nonlyisthebest456
  • 12-01-2024
  • Mathematics
contestada

47000 in standered form

Respuesta :

djp6182583 djp6182583
  • 12-01-2024
4.7 x 10^4 in Standard Form
Answer Link

Otras preguntas

how do U do a 3D model of a project on unit 6 vocabulary for science
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
How to find the % of change with 33 and 68?
A 2.00-g bullet hits and becomes embedded in a 500-kg wood block which is hanging from a 1.20-m long string. This causes the block to swing through an arc of 3.
Please help me . factor. 4x^2+26x+30
Which of the following is not a property of cells: ability to reproduce using energy for growth all cells are the same adapting to their environment its tim
PLEASE HELP ASAPA construction crew is lengthening a road. The road started with a length of 57 miles, and the crew is adding 4 miles to the road each day.
what are 2 examples of economic sanctions
what was Gabriela mistral famous for?
3 X Plus y equals negative 4