markoalejandroacurio markoalejandroacurio
  • 14-03-2024
  • Mathematics
contestada

5) 3; 9; 27; 81; 243; 729 a) 1187 b) 2187 d) 2718 e) N.A c) 2817​

Respuesta :

Otras preguntas

When 4.00 g of hydrogen nuclei fuse to form helium in the sun, 0.0265 g of matter is converted into energy. Using the mass converted to energy and the speed of
On Friday, a local hamburger shop sold a combined total of 303 hamburgers and cheeseburgers. The number of cheeseburgers sold was two times the number of hambur
The world's largest chandelier was built in South Korea and hangs in one of the department stores in Seoul. If the chandelier's mass is 9.7 x 10³ kg and it is l
Answer in miles per hour please.
گر Find the x- and y-intercept of the line. -1.2x + 8.2y = 39.36
A solution that has a high concentration of hydrogen ions has what type of pH? 2 7 13 14 worth 100 points **URGENT**
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
help please, the question in the picture
What best describes this mutation and its effect on the protein that the gene produces? A. It is a missense mutation that changes exactly one amino acid. OB. It
through (-3,-1) perp to y=-1/2x=5PLease ANSWER HURRY