zoiespafford15 zoiespafford15

12-09-2017
Spanish

contestada

Es posible que la terapia de acupresión _______ a aliviar el dolor.

ayudan
ayude
ayuden
ayuda

Respuesta :

crybabyval crybabyval

12-09-2017

Es posible que la terapia de acupresion ayuda a aliviar el dolor

Answer Link

Аноним Аноним

12-09-2017

Es posible que la terapia de acupresión _______ a aliviar el dolor.

ayuda

Answer Link

Otras preguntas

Identify and define poetic devices that involve poets repeating words and sounds. 1. 2. 3. 4. 40 POINTS

Which step occurs after mineral formation

If a government is interested in knowing the total income of its citizens (including remittances, or money earned in a foreign country and sent back home), it s

Her eyes are pearls is an example of what type of figurative language?

Which expression is equivalent to (2x2)(3x3)(4x)2?

Identify the geographic characteristics that affected the ancient Greek civilizations of Minoa and Mycenae.

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

a rectangle has vertices a(2,6), b(2,9), C(7,9), and D(7,6), what is the length of each side of the rectangle?

Why do some groups choose to use terrorism?

Michelle can fold 4 baskets of clothes in 54 minutes, while Ruby can fold 4 baskets of clothes in 108 minutes. How long will it take them to fold 8 baskets of c