babygirlmorrow babygirlmorrow

13-12-2017
History

contestada

A watering method Used to grow crops in a dry areas of the middle east is also known as

Respuesta :

hughes47570 hughes47570

13-12-2017

It is known as spate irrigation, also called floodwater harvesting.

Answer Link

regmmgr regmmgr

13-12-2017

Floodwater harvesting or spate irrigation

Answer Link

Otras preguntas

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

The surface area of a sphere with a diameter of 22 cm. Round your answer to the nearest whole number.

Which description of the term Manifest Destiny is correct? a.the belief that the United States had a right to take control of Central American nations.the belie

Find the measure of

four photographers are taking pictures at a school dance. Photographer A takes 25 of the pictures, Photographer B takes 4% , Photographer C takes 0.29 hey

Find the area of a circular flower bed whose diameter is 4024 feet. (Use π = 3.14 as an approximate value.)

Which type of computer network is a network of multiple LANs, or individual computers connected across wide geographical areas?

Ed borrowed $1,500 for four months at 13.5%. How much did he have to pay back under an add-on plan? a. $1,550.63 b. $1,567.50 c. $67.50 d. $

Select two rations that are equivalent to 3: 12.

Formic acid, which is a component of insect venom, has a ka = 1.8 ´ 10-4. what is the [h3o+] in a solution that is initially 0.10 m formic acid, hcooh? question