jaja11355 jaja11355

13-02-2018
Mathematics

contestada

EXPERTS/ACE/TRUSTED HELPERS helpppp meeeeeeeee plzzzz

EXPERTSACETRUSTED HELPERS helpppp meeeeeeeee plzzzz class=

Respuesta :

musiclover10045 musiclover10045

13-02-2018

using points (1,8) and (7,1)

the equation is y = -7/6x+55/6

B is the answer

Answer Link

Otras preguntas

OMG PLS HELP THIS IS URGENT. What is the rule used to transform ABC to its image? A(-3,5), B(2,8), C(-4,-5) and A(-3, -5), B'(2, -8), C'(-4,5) O A. Rm(x, y)

There are 23 atudents in a math class.Twelve of them are boys.What is the ratio of girls to total number of students.

helppppppp meeee nowwww

Rewrite in simplest terms: -3(-10d+8)+3d−3(−10d+8)+3d

Which line is an example of iambic pentameter?

True or False?? (Help me please)

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Which word is spelled correctly? O 1. scarfs 2. loaves O 3. calfs 4. wifes

On January 1st, the high temperature was 81 °F in kona, hawaii. the low temperatures was 29 °F in Barrow, Alaska. What was the difference in the two temperature

any boys on here that have curly hair, glasses, brown eyes, and are single???