nurulphxp5gf2y
nurulphxp5gf2y nurulphxp5gf2y
  • 12-03-2018
  • Mathematics
contestada

what is 3 groups of 1/8

Respuesta :

Futurevet405 Futurevet405
  • 12-03-2018
1/8+1/8+1/8=3/8
This part below is extra
1/8 x 1/8 x 1/8=1/512
Answer Link

Otras preguntas

on saturday morning, marc had a quarter of his weekly allowance left. he spent a total of 6.50 on bus fares and freshly squeezed orange juice on saturday aftern
what per cent of 23 12​
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39). Write the base sequence of th
Geoff rushed toward the brick entrance as his mother and father struggled to keep up with him. Geoff had been waiting for a long time to visit the Georgia Sport
In box kernel density estimation, _____________________. a. None of the options b. The histogram is decentralized over several data points. c. The histogram is
HELP WILL GIVE BRAINLIEST! SUPA CONFUSED
How many grams of Cl2 are needed to produce 2.4 grams of NaCl? 2Na + Cl2 2NaCl
Of the markets in a certain city , 23/25 offered customers a salad bar in 1998.
Tori is writing a blog with the controlling idea that it's better for people's health and the local economy if they fish locally. What should she do if she disc
what is the term given to those that live during the Paleolithic era​