cbuchanan2020
cbuchanan2020 cbuchanan2020
  • 14-03-2018
  • History
contestada

What types of expenses so businesses have?

Respuesta :

Аноним Аноним
  • 14-03-2018
Phone and utilities
Equipment
Fixtures
Inventory
Leasehold improvements
Licenses and tax deposits

hope this helped :)
alisa202
plzz tell me if I was wrong
Answer Link

Otras preguntas

Identify some of the figure of speech used in the essay nature is not always kind with special emphasis on personification??? ​
A +0.0129 C charge feels a 4110 N force from a -0.00707 C charge. How far apart are they? [?] m
find the measure of angle b87?? please help:)
PLEASE. ITS DUE IN 10 minutes. Anyoneeee
What did some progressives believe could lead to a better human race through selective breeding? A prohibition B temperance С eugenics Dconservation E none of t
what is the area of the polygon with explanation
Which of the following statements about fungi is true? a. All fungi are unicellular b. All fungi have cell walls c. All fungi are prokaryotic d. All fungi are
an someone please solve this -18=m+12
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
Chris tosses two number cubes labeled 1 to 6. What is the probability of rolling double 4s?