Eagles15 Eagles15

12-04-2018
Mathematics

contestada

153/5 from an improper fraction to mixed number

Respuesta :

prestonshelton prestonshelton

12-04-2018

Hello!

You do 153/5 = 30.6

30.6 as a mixed number is 30 3/5

The answer is 30 3/5

Hope this helps!

Answer Link

Fluffy13 Fluffy13

12-04-2018

All you have to do is divide 153/5 which is 30.6. Covert that to a fraction and you get 30 3/5.
Hope this helps :).

Answer Link

Otras preguntas

Someone please please help me with both of these questions :((((

Which of the following is part of the election process for president of France?

How do you do 11. Your supposed to find the ratios

____ is a measure of the amount of matter in an object. (2 points) Density Weight Mass Volume

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

peter’s mom is cooking brownies in a pan in the oven. Which pan should she choose if she wants the pan that will heat up and cool the quickest? a) metal pan b)

Describe effectively communication strategies for gathering information and education patients and the importance of a applying them

Which group of immigrants was officially not allowed into the united states according to a federal "exclusion" act in the late 1800s?

Ethan is short and thin. although he's not very strong or athletic, he excels in academics and has a great sense of humor. according to adler, ethan's attempts

Algebra problem help