rfp9757
rfp9757 rfp9757
  • 15-04-2018
  • Mathematics
contestada

I need an inequality

I need an inequality class=

Respuesta :

peachimin
peachimin peachimin
  • 15-04-2018

The answer is: 0.75x +13 > 25

Answer Link

Otras preguntas

x - y = 3 x + 2y = -6 Giving out brainliest SHOW ALL OF YOUR WORK☺
Which of the following is the most realistic goal for attaining and maintaining mental and emotional health? A. avoid disappointment in life by being strong ins
What two factors explain why topsoil is lost?
The two triangles are congruent as suggested by their appearance. Find the value of c. The diagram is not to scale.
Janie uses a reflecting tool to reflect Point B onto Point A. Which of the following statements are true about the line of reflection? 1. Reflection line is per
The cities of New York, Baltimore, and Philadelphia began to become wealthy in the late-1600s because of what economic activity? A) trading
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
Who can write a paragraph explaining what the world would be like without money?
Characteristics of Renaissance-Baroque cities include _____. ceremonial buildings crowded defensive walls wide streets open spaces winding streets
What is the tone of this paragraph? We must use time creatively, and forever realize that the time is always ripe to do right. Now is the time to make real the