wresatbsabbystanie wresatbsabbystanie

16-02-2016
History

contestada

The British Quakers boycotted sugar to protest _____.
slavery
high taxes
child labor
mercantilism

Respuesta :

HistoryGuy HistoryGuy

26-02-2016

The British Quakers boycotted sugar to protest "high taxes," since many colonists at this time (not just Quakers) believed that taxation was unfair without representation.

Answer Link

Аноним Аноним

20-05-2019

Answer:

taxes :v

Explanation:

Answer Link

Otras preguntas

PLEASE HELP 50 POINTS Write an equation of the line that is parallel to -x + y = 5 and passes through the point (2, -5). Responses y = x - 3 y = x - 3, EndFragm

Simplify -i^32. I think it is -1 but can you confirm? Thanks

in a rectangle, one side is 3 times as long as the other. Now the longest side is extended by 4m. Then the area will be 96 square meters larger. How long were t

please helpppp!!!!!!!!!!!

Hannah's friend Ami would like the group of 5 performers to include more. males than females. The order in which they perform is no longer relevant. iii) Find t

Differences between Indus, Nile, and Yellow river valley civilizations

the base when 4 is the logarithm of 144 is....please give easy step

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Please discuss the successes and failures of the Medieval European crusades in the Holy Lands. What impact did these events have on European society?

A cylindrical tank with radius 5 m is being filled with water at a rate of 4 m3/min. How fast is the height of the water increasing (in m/min)?