logantaylor35 logantaylor35
  • 12-11-2019
  • Mathematics
contestada

Is this inequality linear, quadratic, or neither?
-7x2 + 7xs o
Click on the correct answer.
linear
neither
quadratic

Respuesta :

hallymat03 hallymat03
  • 12-11-2019

Answer:2

Step-by-step explanation:

Answer Link

Otras preguntas

L Question 10 of 10 Look at this statue. Aztec art such as this was often used to decorate: A. the barracks that housed soldiers and military leaders. B. roads
when did the mongols rule china LOL
plz help ASAP plz...........
What is the area of the shaded region
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT
A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer.
What was Stalin's religious policy
How can a shape have perdindicular but not parallel sides?
Simplify: 6a - 9+ 10a.
What ions combine together to form water in a neutralization reaction?