johnokle69
johnokle69 johnokle69
  • 11-12-2020
  • Mathematics
contestada

Find the values of x and y.
40
sy
40
xº
X =
y= 0

Find the values of x and y 40 sy 40 xº X y 0 class=

Respuesta :

akposevictor
akposevictor akposevictor
  • 16-12-2020

Answer:

x = 30°

y = 5

Step-by-step explanation:

The ∆ where you find x is an isosceles ∆ because two of its sides has a length of 40 each, since the other triangle has equal angles of 60° each, it also has equal length sides of 40.

Therefore, x is a base triangle of the isosceles, thus:

x = ½(180 - (180 - 60))

x = ½(180 - 120)

x = ½(60)

x = 30°

Let's find y.

8y = 40 (sides of an equilateral ∆ are equal)

Divide both sides by 8

y = 5

Answer Link

Otras preguntas

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
3×42 using partial products
HELP I’ll make u brainlist
A metal plate has a charge of -3.0 uc. What will be the potential energy of a proton located 5.0mm away
A mechanic is using a machine that makes metal parts. She measures each part to confirm it is the correct size. Negative numbers mean the part is too small, and
How does tom react to pain killer
so When using manual flash mode on your camera, how should you set the ISO speed on the flash? A. slower than the camera's ISO setting B. faster than the came
A circle with a radius of 1 unit and center C at (-2, 1) is reflected across the x-axis. What are the coordinates of C? (2, 1) (2,-1) (-2,4) (-2,-1)
graph y= -3/2x-3 i need to plot the points ​
Select 2 reasons why reforms like the Dawes Act were ineffective White settlers continued to move west seeking more land to settle and farm, as well as gold. Na