jayturnhas9nthanick jayturnhas9nthanick
  • 11-11-2016
  • Business
contestada

In the context of customer satisfaction, which of the following happens when a marketer falls into the trap of underpromising?

Respuesta :

syed514
syed514 syed514
  • 14-11-2016
If you don't set expectations high enough, too few customers will be willing to try your product. The result will be a tiny base of highly satisfied customers, which usually isn't enough to sustain a business it will happen when a marketer falls into the trap of under promising
Answer Link

Otras preguntas

Place the following terms in order from smallest to largest. Which one is the correct order :)
Useful dialogues in moral reasoning usually involve numerous analogies and . In such dialogues, the nature and degree of rarely has undisputed consequences. Lik
Math question down below
How are nitrogen fixing bacteria able to break apart the bonds of nitrogen gas?
1. What was the purpose of the Tennessee law that Charles Baker claimed was not followed? The town is required to give a population statistic every 10 years.
Does anybody know the answer to these questions?
Which of these statements is true about autotrophs, but not heterotrophs? A. They use sugar and oxygen to make carbon dioxide and water. B. They use chlorophyll
Part of the population of 6,250 elk at a wildlife preserve is infected with a parasite. A random sample of 50 elk shows that 5 of them are infected. How many el
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG
Am I right?? :) if I’m not please tell me what’s wronf