benjimin500 benjimin500
  • 14-12-2021
  • Mathematics
contestada

Someone do it for me

Someone do it for me class=

Respuesta :

xlq
xlq xlq
  • 14-12-2021

Answer:

too blurry tbh

Step-by-step explanation:

Answer Link

Otras preguntas

What is the value of x? Show your work. 20x⁰ 8x° 17x PLEASE I NEED HELP ​
Determine the new coordinate location after (-3,7) on the graph y=-x^2 has undergone the following transformation: A reflection in the x axis followed by a vert
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
(8.4x10^11)/(5.25x10^2)(8.0x10^3) express in scientific notation
In a right triangle ABC with acute angles A and B, 5. What is the tangent of B? Write your answer as simplified fraction. it is given that tan A tan B = =
Prizes in a raffle are determined by taking a ball from a bag. There are 15 balls in the bag, 12 of them are green, two of them with black stars. There are two
13. Basically the Federal Reserve increases or decreases the ___to change___
calcular la suma de las aristas de un cubo si su volumen es 64
what describes assimilation of heteronormative ideals into gay lesbian queer culture
A farmer has 300 yards of fencing. He is trying to figure out how to build his fence so that he has a rectangle with the greatest square footage inside. What ar