shiliecebrutonp2nwv2 shiliecebrutonp2nwv2

16-01-2018
Health

contestada

what does the term discrediting mean? How is it used in the selling of exercise and nutritional products?

Respuesta :

M2th913 M2th913

17-01-2018

Discrediting means harming the good reputation of someone or something. discrediting is used by selling products and nutritional .

Answer Link

Otras preguntas

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT

someone pls help me will mark u brainliest

The impact of discrimination behaviour to an individual

How are the components of a vector determined mathematically?

what does this : mean in math for 6th grade

100 POINTS PLEASE HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Rachel found that the time it takes

the stove you have to bake in is an old one and only has the temperature in ° Fahrenheit. You are making rusks and have to dry them overnight at a temperature o

Find the surface area of the net:

Last question!!!!!explain if posible

393/9 with remainder